Le suivi épidémiologique des eaux usées : un indicateur privilégié dans une stratégie de lutte intégrée contre le CODIV-19

Mise à jour du 25 janvier 2021

Les laboratoires du consortium OBEPINE  impliqués dans  le séquençage du SARS CoV 2 dans les eaux usées attirent l’attention de leurs collègues sur   le kit Swift Amplicon SARS-CoV-2 Research Panel (SWIFT Bioscience) permettant la préparation de librairies pour permettre le séquençage.

En effet, la séquence de deux oligonucléotides du panel couvre des mutations d’intérêt utilisées pour l’identification des différents variants (en gras sur les oligos concernés).

Del 69-70           21787   21895   covid19genome_200-29703_s20720_D_13              ACATGTCTCTGGGACCAATGGT

N501Y                 23070   23173   covid19genome_200-29703_s20720_D_27              GGTTTCCAACCCACTAATGGTGT

Ceci peut entrainer un défaut potentiel d’amplification de certains variants rendant difficile l’identification des mutations (SNP et insertion-délétion) dans le méta génome.


publié le 12 mai 2020

Le suivi épidémiologique des eaux usées : un indicateur privilégié dans une stratégie de lutte intégrée contre le CODIV-19. Le Projet OBEPINE (OBservatoire EPIdémiologique daNs les Eaux usées)

L’évaluation de la dynamique de l’infection à SARS-CoV2 dans les populations humaines est limitée aux données épidémiologiques recueillies dans un contexte d’urgence (incidence, hospitalisations, décès, létalité, tests viraux sur les malades et les personnels exposés), qui ne reflète qu’imparfaitement la dynamique réelle de l’infection COVID-19.

Le cycle viral admet, en plus des phases affectant les voies respiratoires supérieures et inférieures, une phase entérique qui aboutit à la libération de virus dans les selles (Wölfel et al., 2020), mais l’inféctivité du virus issu des selles n’est pas encore démontré pour le SARS-CoV2.

C’est pourquoi la surveillance du SARS-CoV2 dans les eaux usées, reflet indirect de la circulation du virus dans la population, pourrait constituer un nouvel indicateur de choix en complément des données épidémiologiques actuelles. La surveillance des eaux usées fournit un signal global et complémentaire pour toute la population drainée par le même réseau d’eaux usées, alors que tous les autres moyens de surveillance sont centrés sur les individus. Le suivi des virus entériques dans les eaux usées avait déjà démontré une très bonne corrélation avec la circulation des virus dans les populations, notamment à Paris (Prévost et al., 2015) ou encore au Japon (Kazama et al., 2016). Plusieurs éditoriaux et articles d’opinion se sont fait récemment fait l’écho du potentiel du suivi épidémiologique des eaux usées (Malapathy, 2020, Lesté-Lasserre, 2020, Maréchal et al. 2020).

Un groupe de travail réunissant des expertises en virologie médicale, en microbiologie environnementale, en hydrologie, en modélisation et en mathématiques statistiques s’est proposé de créer le réseau OBEPINE (Observatoire EPIdémiologique daNs les Eaux usées). Ce projet, qui associe les opérateurs privés et publiques en charge du traitement des eaux usées, a proposé une stratégie originale de surveillance épidémiologique du COVID-19. Des données préliminaires (Wurtzer et al., 2020) montrent en effet que le génome du SARS-CoV2 peut être quantifié dans les eaux usées issues de stations d’épuration (STEP) d’Ile-de-France. Ce suivi permet une détection très précoce de l’épidémie (eaux usées positives dès le 5 mars, alors que moins de 100 cas sont déclarés en Ile de France) suggérant que la détection du coronavirus dans les eaux usées pourrait précéder la détection des premiers malades. Les auteurs rapportent une baisse drastique des charges virales dans les eaux usées depuis le 10 avril, témoignant d’une réduction dans la circulation du virus depuis la mise en place du confinement le 17 mars.

Une stratégie proche a été mise en avant dans des études conduites très récemment aux Pays-Bas (Medema et al., 2020). A court terme, la surveillance des eaux usées permettrait de suivre la dynamique de circulation du SARS-CoV2 dans des régions cibles, notamment à faible circulation virale, en sus d’autres indicateurs épidémiologiques.

A long terme, ce réseau pilote pourrait préfigurer la construction d’un réseau national pérenne de suivi des eaux usées qui permettrait, tout au long de l’année, de suivre la circulation des pathogènes entériques dans la population française.

Le projet OBEPINE regroupe :
Jean-Luc Bailly1 Maître de conf., HDR. Enseignant-Chercheur, virologie, épidémiologie moléculaire
Christophe Gantzer2 Professeur de Microbiologie. Enseignant-Chercheur (virus dans l’environnement)
Yvon Maday3 Professeur de Mathématiques Appliquées et Directeur de l’Institut Carnot Smiles
Vincent Maréchal4 Professeur de Virologie. Enseignant-Chercheur (virologie humaine)
Jean-Marie Mouchel5 Professeur, Hydrologue et géochimiste, spécialiste des milieux urbains
Laurent MoulinDocteur en Microbiologie, HDR, Responsable du laboratoire R&D Eau de Paris
Remy Teyssou7 Professeur Agrégé du Val de Grâce, Directeur du l’Unité de Virologie de l’IRBA
Sébastien Wurtzer6   Docteur en Virologie, Ingénieur au laboratoire R&D Eau de Paris

1 Laboratoire Microorganismes, Génome et Environnement (LMGE), UMR 6023 CNRS-Université Clermont Auvergne, 63000 Clermont-Ferrand
2 Laboratoire de Chimie Physique et Microbiologie pour les Matériaux et l’Environnement (LCPME), UMR 7564 CNRS-Université de Lorraine, Nancy
3 Sorbonne Université, Laboratoire Jacques-Louis Lions (UMR 7598) et Institut Universitaire de France,
4 Sorbonne Université, INSERM, Centre de Recherche Saint-Antoine, F-75012, Paris, France.
5 Sorbonne Université, CNRS, EPHE, UMR 7619 Metis, 75005 PARIS, e-LTER Zone Atelier Seine,
6 Eau de Paris, Laboratoire R&D, 94200 Ivry
7 Institut de Recherche Biomédicale des Armées,   

Références

  • Kazama S, Masago Y, Tohma K, Souma N, Imagawa T, Suzuki A, Liu X, Saito M, Oshitani H, Omura T (2016) Temporal dynamics of norovirus determined through monitoring of municipal wastewater by pyrosequencing and virological surveillance of gastroenteritis cases. Water Research 92:244–253 . https://doi.org/10.1016/j.watres.2015.10.024
  • Lesté-Lasserre Apr. 21 C, 2020, Pm 2:10 (2020) Coronavirus found in Paris sewage points to early warning system. In: Science | AAAS. https://www.sciencemag.org/news/2020/04/coronavirus-found-paris-sewage-points-early-warning-system. Accessed 26 Apr 2020
  • Mallapaty S (2020) How sewage could reveal true scale of coronavirus outbreak. Nature 580:176–177 . https://doi.org/10.1038/d41586-020-00973-x
  • Marechal V. (2020). On a retrouvé le coronavirus dans les eaux usées, et cela pourrait nous aider à mieux suivre l’épidémie. In: The Conversation. Accessed 26 Apr 2020.
  • Prevost B, Lucas FS, Goncalves A, Richard F, Moulin L, Wurtzer S (2015) Large scale survey of enteric viruses in river and waste water underlines the health status of the local population. Environment International 79:42–50 . https://doi.org/10.1016/j.envint.2015.03.004
  • Wurtzer S, Marechal V, Mouchel J-M, Moulin L (2020) Time course quantitative detection of SARS-CoV-2 in Parisian wastewaters correlates with COVID-19 confirmed cases. Epidemiology. http://medrxiv.org/lookup/doi/10.1101/2020.04.12.20062679
Partager cet Article
Avez-vous aimé cet article ?
2 0
27 Comments
  1. lipitor 40mg for sale order lipitor 40mg generic how to buy atorvastatin

    Répondre
  2. order finpecia sale order generic forcan forcan for sale

    Répondre
  3. purchase cipro – myambutol usa augmentin 1000mg without prescription

    Répondre
  4. buy ciprofloxacin no prescription – order ciprofloxacin 500mg sale erythromycin drug

    Répondre
  5. metronidazole over the counter – order oxytetracycline generic order azithromycin online

    Répondre
  6. ivermectin 3 mg for humans for sale – where to buy ceftin without a prescription cost tetracycline 500mg

    Répondre
  7. valtrex 1000mg generic – valtrex 500mg cost buy generic acyclovir for sale

    Répondre
  8. purchase ampicillin pills penicillin online order cheap amoxicillin generic

    Répondre
  9. brand metronidazole 200mg – cleocin 300mg over the counter zithromax brand

    Répondre
  10. order lasix for sale – capoten sale buy capoten 120mg without prescription

    Répondre
  11. metformin 1000mg generic – cefadroxil 500mg pills order lincomycin 500mg online cheap

    Répondre
  12. nice content!nice history!! boba 😀

    Répondre
  13. nice content!nice history!! boba 😀

    Répondre
  14. zidovudine 300 mg ca – rulide 150 mg price buy allopurinol paypal

    Répondre
  15. clozapine 100mg canada – buy accupril 10mg online order pepcid 20mg generic

    Répondre
  16. buy seroquel 100mg online cheap – buy seroquel paypal eskalith online

    Répondre
  17. clomipramine 25mg generic – where can i buy asendin purchase sinequan

    Répondre
  18. atarax 10mg pills – order hydroxyzine 10mg sale buy amitriptyline 25mg for sale

    Répondre
  19. buy augmentin 1000mg without prescription – pill ethambutol 1000mg oral ciprofloxacin

    Répondre
  20. cheap amoxicillin online – buy generic cefuroxime 500mg generic cipro 1000mg

    Répondre
  21. azithromycin 250mg cheap – order sumycin sale ciplox price

    Répondre
  22. how to buy clindamycin – order oxytetracycline buy chloromycetin pills for sale

    Répondre
  23. ivermectin for human – ivermectin 3mg for people purchase cefaclor generic

    Répondre
  24. purchase albuterol inhalator online cheap – seroflo price theophylline order online

    Répondre
  25. buy desloratadine 5mg sale – ketotifen brand albuterol oral

    Répondre
  26. glyburide price – glipizide tablet dapagliflozin price

    Répondre
  27. how to buy glucophage – buy losartan tablets precose buy online

    Répondre

Laisser une réponse

Votre adresse e-mail ne sera pas publiée. Les champs requis sont marqués *

You may use these HTML tags and attributes: <a href="" title=""> <abbr title=""> <acronym title=""> <b> <blockquote cite=""> <cite> <code> <del datetime=""> <em> <i> <q cite=""> <s> <strike> <strong>